L’expression de protéine de cytomégalovirus d’Intragraft est associée à la survie diminuée d’allogreffe rénale

Contexte L’infection par le cytomégalovirus CMV est un facteur de risque de rejet aigu et chronique des organes transplantés et serait indirectement responsable du rejet.méthodes Dans cette étude de cohorte observationnelle rétrospective, des biopsies de stade précoce et final des allogreffes rénales perdues à cause d’un dysfonctionnement chronique de l’allogreffe ont été examinées. Les protéines CMV immédiates-précoces et tardives étaient présentes dans% des biopsies de dysfonctionnement allogreffe chronique en phase terminale et dans% des biopsies précoces correspondantes mais non dans les biopsies précoces correspondantes. La durée de survie du greffon a été réduite chez les patients ayant des taux de CMV modérés ou élevés dans la greffe peu de temps après la transplantation par rapport à celle des patients n’ayant pas ou peu de CMV dans la greffe. Aucune différence significative n’a été observée dans le sérum. créatinine obtenue lors de biopsies précocesConclusions La preuve que l’expression de la protéine CMV intragraft est associée au dysfonctionnement de l’allogreffe rénale chronique en phase terminale, que les taux de CMV intragraux augmentent à mesure que la fonction du greffon se détériore et que l’expression des protéines CMV dans les greffes est associée à une survie réduite du greffon. un rôle pathologique dans le dysfonctionnement chronique de l’allogreffe rénale

Cytomegalovirus humain CMV est un β-herpesvirus qui établit latence et persistance après une infection primaire Bien que généralement subclinique chez les patients immunocompétents, l’infection par CMV pose de sérieux problèmes chez les patients immunodéprimés Dans une réponse inflammatoire hôte, les monocytes latent se différencient en macrophages et cellules dendritiques, Grâce à ses capacités immunomodulatrices étendues, le CMV peut induire et maintenir une réponse inflammatoire, prolongeant ainsi la période de réplication virale L’infection à CMV a été associée à un rejet aigu et chronique du greffon et à d’autres complications à long terme après la réplication virale. transplantation, comme un risque accru d’infections bactériennes et fongiques, de maladies cardiovasculaires, de diabète et de malignités Une variété de mécanismes CMV ont été impliqués dans les dommages allogreffés CMV peut infecter une variété de types cellulaires, et une infection lytique dans ces cellules peut conduire pour diriger les dommages tissulaires CMV a ouvert readi La plupart des protéines CMV servent à contrôler les fonctions cellulaires et immunologiques qui aident le virus à coexister avec son hôte. De manière importante, la réplication du CMV dépend Le CMV contrôle également la différenciation cellulaire, induit la migration et la prolifération, et favorise l’angiogenèse, qui peuvent tous contribuer à la pathologie de la maladie dans la greffe. Le CMV peut également induire une réponse inflammatoire par divers mécanismes qui peuvent contribuer aux dommages d’allogreffe. exemple, la protéine CMV US, un homologue des récepteurs de chimiokines qui induit la migration des cellules musculaires lisses, a été attribuée à une signification spécifique dans le développement de la sclérose vasculaire Suppression de l’homologue du rat correspondant, R, dans un modèle de transplantation cardiaque réduite % Néanmoins, une infection à CMV active au sein d’une greffe est rarement détectée, et les dommages à l’allogreffe On pense que ce phénomène est dû à des phénomènes immunitaires après infection par le CMV, des effets indirects du CMV Une cause majeure de perte tardive du greffon chez les transplantés rénaux est le dysfonctionnement chronique de l’allogreffe, qui peut être dû à des causes spécifiques telles que le rejet chronique. hypertension artérielle ou infections microbiennes ou étiologie mal définie Jusqu’à% de greffes rénales sont affectées des années après transplantation, malgré des améliorations du traitement immunosuppresseur L’inflammation persistante est importante pour les dommages progressifs de l’allogreffe Parce que l’infection à CMV dépend de l’inflammation. En effet, l’infection persistante par le CMV dans les reins transplantés est en corrélation avec une augmentation des taux de créatinine et une réduction de la survie des allogreffes , et une infection à CMV ou une maladie, évaluée par l’antigénémie pp. , est en corrélation avec un dysfonctionnement chronique de l’allogreffe Bien que le CMV soit spécifique d’une espèce, des études Cependant, aucun lien de cause à effet clair entre l’infection à CMV et le dysfonctionnement chronique de l’allogreffe n’a été établi chez les humains Nous avons émis l’hypothèse que les protéines CMV dans la greffe, plutôt que secondaire les phénomènes immunitaires dus à la virémie CMV, favorisent le dysfonctionnement chronique de l’allogreffe rénale Dans cette étude, nous avons évalué la prévalence et l’association intravéhiculaire du CMV avec un dysfonctionnement chronique de l’allogreffe rénale

MATÉRIAUX ET MÉTHODES

Les patients

Les greffes ont été prélevées à l’hôpital universitaire d’Uppsala. Les patients ont reçu leurs greffes entre le mois d’août et le mois de février médian de janvier et ont été inclus si la transplantectomie a été réalisée et le diagnostic histopathologique de fin de greffe. La dysfonction chronique de l’allogreffe a été confirmée En plus des biopsies au stade terminal, nous avons également évalué les premières biopsies disponibles chez ces patients; Nous avons également évalué les premières biopsies disponibles d’une cohorte de patients témoins Table avec une allogreffe fonctionnant bien définie comme la créatinine sérique ≤ μmol / L plusieurs années après la transplantation Les patientes des deux groupes ont été incluses indépendamment du donneur ou du séropositif du CMV Pour la validation de l’immunohistochimie, des biopsies à temps zéro de donneurs rénaux séronégatifs pour le CMV ont été réalisées. Les biopsies rénales d’un patient présentant des signes histopathologiques d’infection à CMV ont été utilisées comme témoins positifs. En outre, des reins cicatrisés explantés provenant de patients non transplantés ont été utilisés pour établir le seuil de détection du CMV. L’étude a été approuvée par le comité d’éthique de l’hôpital universitaire Karolinska / –

Tableau Analyse des biopsies rénales chez des patients présentant un dysfonctionnement chronique de l’allogreffe et des patients ayant des allogreffes fonctionnelles Caractéristiques du patient Cohorte de dysfonctionnements chroniques n = Cohorte fonctionnelle n = Valeur P Âge moyen, années ± écart-type ± ± P = sexe, non% NS Homme Femme Épisode clinique d’infection à CMV, n% NS sérologique CMV, n% P = D / R D- / R D / R- D- / R- R R- Prophylaxie inconnue au CMV, n% NS CMV IEA / LA grade , n% / n% Biopsie précoce n = Biopsie au stade ultime n = Biopsie précoce n = Négative / / / Faible / / / Modérée / / / Élevée / / Épisode de rejet nécessitant un traitement, n% NS Cause de l’insuffisance rénale terminale , n% NS Glomérulonéphrite chronique Néphropathie diabétique Rys polykystiques IgA glomérulonéphrite Syndrome d’Alport Autres Traitement immunosuppresseur, n% NS Inhibiteur de la calcineurine, prednisolone et mycophénolate mofétil / azathioprine Autres Transplantation primitive, oui, n% P = donneurs, n% NS Vivant décédé ± SD ± NA Caractéristiques du patient Cohorte de dysfonctionnements chroniques n = Cohorte fonctionnelle n = Valeur P Âge moyen, années ± SD ± ± P = Sexe, non% NS Homme Femme Infection clinique à CMV, n% NS Affinité sérologique CMV, n% P = D / R D- / R D / R- D- / R- R R- Prophylaxie inconnue au CMV, n% NS CMV IEA / LA grade, n% / n% Biopsie précoce n = Biopsie au stade ultime n = Biopsie précoce n = Négative / / / Faible / / / Modérée / / / Élevée / / Épisode de rejet nécessitant un traitement, n% NS Cause de maladie rénale terminale, n% NS Glomérulonéphrite chronique Néphropathie diabétique Rys polykystiques IgA glomérulonéphrite Syndrome d’Alport Autres Traitement immunosuppresseur, n% NS Inhibiteur de la calcineurine, prednisolone et mycophénolate mofétil / azathioprine Autres Greffe primaire, oui, n% P = donateurs, n% NS vivant décédé Transpla moyen nt période de survie, mois ± SD ± NA Abréviations: SD, écart-type; CMV, cytomégalovirus; AIE, antigène immédiat-précoce; LA, antigène tardif; D, donneur séropositif pour le CMV; Donneur D-, CMV-séronégatif; R, receveur séropositif pour le CMV; R-, récepteur CMV-séronégatif; IgA, immunoglobuline A; NS, non significatif; NA, non applicableVoir grand

Immunohistochimie

Un pathologiste a noté les biopsies en utilisant les critères de rejet de Banff; Pour la coloration immunohistochimique des antigènes du CMV, nous avons coupé les coupes de tissu – μm d’épaisseur. Nous avons déparaffiné les lames dans le xylène VWR International suivi d’une réhydratation par une série d’éthanol descendant% -% Après fixation en% de formaldéhyde tamponné neutre APL, nous avons traité les lames avec de la pepsine BioGenex pendant minutes à ° C Nous avons ensuite soumis les lames à la récupération d’antigène dans le tampon citrate BioGenex Nous avons effectué blocage avec% hydrogène peroxydase Merck, avidine, biotine DakoCytomation, et le blocage des récepteurs Fc et Background Buster Block à la fois de Innovex Biosciences, tous à température ambiante Les coupes ont été incubées pendant une nuit à ° C avec des immunoglobulines IgG monoclonales de souris et des anticorps spécifiques de l’antigène IRA immédiat-précoce du CMV; le clone B; Chemicon International ou antigène tardif LA; le clone D; Chemicon International, LA IgGK; Argene, clones pp et IgGκ; Novocastra Laboratories, la kératine États-Unis biologique, ou l’actine muscle lisse alpha BioGenex; Ces dernières ont servi de témoins Pour la visualisation, nous avons utilisé un système de détection de peroxydase de raifort. Système de détection d’étiquettes Super Sensitive Link de BioGenex Enfin, les cellules positives ont été visualisées avec le chromogène diaminobenzidine Innovex Biosciences Produits Histolab moyensNous avons classé les niveaux d’infection à CMV dans les biopsies en fonction du pourcentage de cellules positives pour le CMV: négatif, faible ≤%, modéré% -% ou élevé ≥%

Hybridation in situ

Pour l’hybridation in situ, nous avons prétraité les sections comme décrit précédemment et les avons déshydratées dans une série ascendante d’éthanol% -% avant dénaturation. Les échantillons ont été dénaturés à oC pendant quelques minutes en présence de sondes marquées à la fluorescéine spécifiques de l’ADN du CMV humain. le contrôle, et la séquence complémentaire du contrôle négatif de l’ARN du virus du dendroctone noir; tous d’InnoGenex dans un thermocycleur Misha DakoCytomation Les lames ont été lavées deux fois dans X SSC citrate salé SSC à oC, deux fois dans X SSC à température ambiante, et une fois dans X SSC à oC, après hybridation pendant une nuit à oC dans une chambre humidifiée Nous avons effectué blocage Nous avons incubé des coupes de tissus avec des anticorps de souris contre la fluorescéine InnoGenex, et nous avons détecté des cellules positives en utilisant le système Link Label Detection System basé sur la peroxydase de raifort ou un système de détection de la phosphatase alcaline de BioGenex Les cellules positives ont été visualisées avec du diaminobenzidène ou du nitro bleu tétrazolium / -bromo-chloro-indolyl phosphate NBT / BCIP comme chromogène

Réaction en chaîne de la polymérase en temps réel pour la détection immédiate et précoce de l’ADN du cytomégalovirus

L’ADN a été isolé à partir de coupes de paraffine en utilisant le kit d’extraction d’ADN Pico Pure Life Technologies selon les instructions du fabricant. Les niveaux de gènes IE immédiats-précoces du CMV humain ont été évalués en utilisant une amorce directe d’essai d’expression personnalisée TaqMan: ‘GTGACCCATGTGCTTATGACTCTAT’; rapporteur: -carboxyfluorescéine- TTGGTCACGGGTGTCTC-MGBNFQ; amorce inverse: ‘CTCAACATAGTCTGCAGGAACGT’ Life Technologies Nous avons effectué une réaction en chaîne par polymérase en temps réel PCR en utilisant l’ABI Prism HT, et les analyses subséquentes ont été effectuées en utilisant le logiciel fourni SDS Tous les échantillons ont été normalisés à la ribonucléase valeur normalisée pour le contrôle positif en tant que calibrateur pour l’obtention des niveaux relatifs d’ADN CMV IE

Analyses statistiques

Nous avons évalué les différences dans les variables catégorielles des patients avec χ ou le test exact de Fisher. Nous avons utilisé les courbes de Kaplan-Meier pour évaluer la survie du greffon. Les différences dans les courbes ont été déterminées avec: Le test log-rank et le test log-rank pour la tendance Les différences dans la distribution des variables continues ont été évaluées en utilisant le test t ou le test de Mann-Whitney, selon le cas. Une analyse de variance unidirectionnelle a été utilisée pour tester les différences de taux de créatinine entre les populations de patients Les analyses ont été réalisées avec le logiciel GraphPad Prism ou MedCalc; P & lt; a été considéré comme statistiquement significatif

RÉSULTATS

Présence De L’ADN De Cytomegalovirus Et Des Protéines Dans Les Allogreffes Rénales Avec Dysfonction chronique Allogreffe De Stade

La majorité des patients présentant un dysfonctionnement allogreffon chronique en phase terminale étaient séropositifs pour le CMV ou recevaient une allogreffe d’un donneur séropositif. Dans le cas où le sérum du donneur et du receveur CMV n’était pas connu, un donneur séronégatif pour le CMV, un patient séronégatif -seronegative destinataire, pour qui le statut sérologique du donneur n’était pas connu, une infection cliniquement suspectée CMV survenue mais le patient n’a pas séroconverti Seul les patients% ont reçu une prophylaxie anti-CMV et% ont eu un épisode clinique d’infection à CMV vérifié par culture virale, PCR ou Nous avons d’abord analysé des biopsies rénales de néphrectomies de greffe chez des patients présentant un dysfonctionnement de l’allogreffe chronique en phase terminale pour CMV IEA et LA Table La greffe a été réalisée par immunohistochimie avec des antiviraux. néphrectomies ont été effectuées à une médiane de plusieurs mois, mois Figure A-D, Tableau En% des biopsies en phase terminale, de faibles niveaux de protéines CMV ont été trouvés, alors que des niveaux modérés et élevés ont été détectés en% et% de biopsies, respectivement les protéines CMV ont été détectées. Présente dans les cellules endothéliales, glomérulaires et tubulaires La présence de protéines CMV a été confirmée chez des patients qui ont été testés positifs par immunohistochimie avec des anticorps CMV supplémentaires contre pp et LA Figure E-H

Figure vue largeDownload slideIn allogreffes rénales avec un dysfonctionnement chronique en phase terminale, une forte expression de cytomégalovirus CMV immédiate-antigène précoce IEA; A, B et l’antigène tardif LA; C, D a été détecté Les résultats ont été confirmés chez les patients avec des colorations pour CMV pp E, F et un autre LA G, H Les zones dans les plus petits rectangles sont agrandies en B, D, F et H Aucune coloration positive n’a été observée dans La biopsie d’un patient ayant subi une transplantation avec une infection intravasculaire à CMV histopathologiquement vérifiée s’est révélée positive pour l’IEA K et LA L. Les résultats ont été confirmés par des biopsies sélectionnées in situ. hybridation pour CMV ADN M, N Le contrôle négatif n’a montré aucune coloration positive O, P Les zones dans les plus petits rectangles sont agrandies en N et PF Vue largeDownload slideInallergies rénales avec un dysfonctionnement chronique en phase terminale, haute expression du cytomégalovirus CMV antigène immédiat-précoce IEA A, B et l’antigène tardif LA; C, D a été détecté Les résultats ont été confirmés chez les patients avec des colorations pour CMV pp E, F et un autre LA G, H Les zones dans les plus petits rectangles sont agrandies en B, D, F et H Aucune coloration positive n’a été observée dans La biopsie d’un patient ayant subi une transplantation avec une infection intravasculaire à CMV histopathologiquement vérifiée s’est révélée positive pour l’IEA K et LA L. Les résultats ont été confirmés par des biopsies sélectionnées in situ. hybridation pour CMV ADN M, N Le contrôle négatif n’a montré aucune coloration positive O, P Les zones dans les plus petits rectangles sont amplifiées dans N et PWe ont également évalué les biopsies prétransplantation de donneurs rénaux séronégatifs pour le CMV et un transplanteur rénal avec une infection intracrânienne CMV histopathologiquement vérifiée. , qui ont servi de témoins négatifs et positifs, respectivement. Les biopsies de donneurs séronégatifs ont été négatives pour les antigènes CMV Figure I, où s La biopsie du patient infecté était positive. La Figure K-LTa confirmait la présence de CMV, l’hybridation in situ de l’ADN du CMV était réalisée chez les patients et présentait une présence étendue d’ADN du CMV. Figure M-P La distribution de l’ADN du CMV l’hybridation in situ est bien corrélée avec la distribution de l’antigène CMV En outre, nous avons également évalué la présence d’ADN du CMV IE dans les biopsies du patient en utilisant la PCR en temps réel. L’ADN du CMV IE a été trouvé dans tous les échantillons examinés et dans les biopsies rénales. Les niveaux d’ADN d’IE étaient plus élevés que dans une biopsie de glande surrénale avec des corps d’inclusion de CMV, qui a été utilisé comme témoin positif.

Figure View largeDownload slidePrésence de cytomégalovirus CMV ADN immédiat immédiat a été confirmé chez des patients utilisant la réaction en chaîne de la polymérase en temps réel Comme un contrôle positif, nous avons utilisé une biopsie surrénale avec une infection à CMV histopathologiquement vérifiée chez un patient atteint de SIDA. L’ADN précoce a été confirmé chez des patients utilisant la réaction en chaîne par polymérase en temps réel. En tant que témoin positif, nous avons utilisé une biopsie de glande surrénale avec une infection à CMV histopathologiquement vérifiée d’un patient atteint du SIDA.

Expression De Protéine De Cytomegalovirus Intragraft Dans Les Biopsies Post-Transplant Précoce De Patients Avec Dysfonction Chronique D’allogreffe

Chez les patients, nous avons également examiné la première biopsie rénale disponible après transplantation, obtenue à une médiane de mois, mois Toutes les biopsies ont été obtenues pour des indications cliniques et% présentaient des signes histopathologiques de rejet Des niveaux faibles de CMV ont été trouvés dans des biopsies de patients %, alors que les taux de CMV modérés et élevés ont été trouvés en% et% des biopsies des patients, respectivement Figure A-D et Figure I-J Des patients ont eu des biopsies précoces qui étaient négatives pour CMV Bien que les antigènes CMV les biopsies précoces, les niveaux de CMV étaient significativement plus faibles que dans les biopsies au stade terminal P = pour l’IEA; P = pour LA Figure; Tableau Dans tous les cas sauf chez les patients, les taux intracrâniens de CMV ont augmenté ou étaient inchangés entre les biopsies précoces et terminales Figure K-L

Les biopsies rénales obtenues au début de la transplantation ont montré une expression modérée ou élevée de cytomégalovirus CMV immédiat-antigène précoce IEA A et l’antigène tardif LA B; alpha-SMA musculaire actine α-SMA a servi de contrôle positif C et la kératine comme contrôle négatif DE-H, les biopsies obtenues précocement après la transplantation de patients avec des allogreffes fonctionnelles à long terme ont montré plus fréquemment expression à faible niveau d’antigènes CMV E , F L’image dans le grand rectangle E, F est une zone agrandie de la plus petite Nous avons utilisé α-SMA comme un contrôle positif G et la kératine comme un contrôle négatif HI et J, Distribution des biopsies selon CMV IEA I et LA J Niveaux d’infection Corrélation pour chaque patient entre la biopsie précoce et finale selon les niveaux CMV IEA K et LA L L’épaisseur de chaque ligne est proportionnelle au nombre de patients. Vue en grosDownload slideA-D, In des patients avec un dysfonctionnement chronique de l’allogreffe , les biopsies rénales obtenues tôt après la greffe ont montré une expression modérée ou élevée de cytomégalovirus CMV immédiate-antigène précoce IEA A et antigène tardif LA B; alpha-SMA musculaire actine α-SMA a servi de contrôle positif C et la kératine comme contrôle négatif DE-H, les biopsies obtenues précocement après la transplantation de patients avec des allogreffes fonctionnelles à long terme ont montré plus fréquemment expression à faible niveau d’antigènes CMV E , F L’image dans le grand rectangle E, F est une zone agrandie de la plus petite Nous avons utilisé α-SMA comme un contrôle positif G et la kératine comme un contrôle négatif HI et J, Distribution des biopsies selon CMV IEA I et LA J niveaux d’infection Corrélation pour chaque patient entre la biopsie précoce et la biopsie au stade final selon les niveaux CMV IEA K et LA L L’épaisseur de chaque ligne est proportionnelle au nombre de patients

Expression De Protéine De Cytomegalovirus Intragraft Est Moins Prévoyante En Allogreffes Fonctionnant Bien À Long Terme

Pour déterminer si la post-transplantation précoce intragravite du CMV est associée à un dysfonctionnement chronique de l’allogreffe, nous avons analysé des biopsies post-transplantation précoces de témoins avec des allogreffes fonctionnelles à long terme définies comme un taux sérique de créatinine ≤ μmol / L. cohorte avec des allogreffes fonctionnelles et la cohorte dysfonction allogreffe chronique en âge à la transplantation, les numéros de transplantation primaire, et le statut sérologique du donneur et du receveur CMV Tableau Basiliximab a été administré comme traitement d’induction aux patients de la cohorte avec des allogreffes fonctionnelles. groupe à long terme fonctionnant bien ont été obtenus à une médiane de mois range-mois; % présentaient des signes histopathologiques de rejet, qui étaient bénins dans le grade A de Banff et plus graves et accompagnés d’une vascularite. Le grade de Banff dans Intragraft CMV IEA était significativement moins prévalent P = pour l’IEA; P = pour LA que dans les biopsies post-transplantation précoce chez les patients présentant un dysfonctionnement chronique de l’allogreffe Aucun CMV n’a été détecté dans les greffes%, les allogreffes% ont des niveaux de CMV faibles et dans certains cas seulement des niveaux modérés de CMV ont été trouvés.

Expression De Protéines Intragraft De Cytomegalovirus Haut Peu Après La Transplantation Est Associée À La Survie Allogreffe Réduite

Les taux intracrâniens de CMV augmentant à mesure que la fonction du greffon se détériorait et étaient plus élevés dans les biopsies précoces du groupe dysfonctionnement chronique de l’allogreffe que dans les biopsies précoces de la cohorte témoin. dysfonctionnement de l’allogreffe chronique, la présence de CMV modérée ou élevée dans les biopsies greffées précoces était associée à une survie réduite du greffon comparativement aux patients ayant une CMV moyenne ± écart-type [SD] faible ou nulle, ± mois vs ± mois et ± mois , respectivement; P = Figure La créatinine sérique obtenue au moment de la biopsie initiale n’était pas significativement différente chez les patients sans CMV par rapport aux patients avec des niveaux intragravites CMV faibles ou modérés / élevés moyenne ± SD, ± μmol / L vs ± μmol / L et ± μmol / L, respectivement; P = Une infection clinique à CMV a été observée chez des patients% présentant une infection modérée et élevée et chez% des patients présentant une expression faible en protéines CMV

Le temps de survie était plus faible chez les patients présentant des infections à cytomégalovirus intravasculaire à CMV tôt ou tard après la transplantation que chez ceux n’ayant pas ou peu d’expression de la protéine intragraft CMV ± écart-type, ± mois vs ± mois et ± mois; Le temps de survie était plus faible chez les patients présentant des infections à cytomégalovirus intravagéniques CMV de stade modéré ou élevé tôt après la transplantation que chez ceux n’ayant aucune ou faible expression intravéhiculaire de CMV ± écart type, ± mois vs ± mois et ± mois ; P =

DISCUSSON

Il s’agit d’un organe cible bien connu pour l’infection à CMV, et CMV a été démontré en% des allogreffes rénales perdues à cause d’une néphropathie chronique L’ADN du CMV a été démontré dans les allogreffes rénales chez% des patients. fonction de greffe à terme; Dans la plupart des études, l’expression des protéines CMV dans les allogreffes rénales est rarement détectée, et donc les effets reconnus du CMV sur le rejet du greffon sont considérés comme indirects. Le faible taux de détection du CMV intragratique Les protocoles d’immunohistochimie automatisés fréquemment utilisés dans le cadre clinique pour la détection du CMV ont été évalués dans plusieurs études, et leur sensibilité a été jugée modérée Dans notre étude, nous avons utilisé un manuel et plus sensible. Protocole immunohistochimique optimisé pour détecter les antigènes CMV En utilisant ces protocoles de coloration, les protéines CMV sont fréquemment détectées dans les cellules tumorales de cancers d’origine différente mais pas dans les tissus sains entourant les tumeurs des changements histologiques caractéristiques de l’infection à CMV ont une très haute spécificité, la sensibilité Par conséquent, l’immunohistochimie est une méthode privilégiée car elle permet la détection du CMV avant l’apparition des changements histopathologiques caractéristiques du CMV Dans notre étude, l’expression protéique du CMV a été retrouvée en% des biopsies précoces chez des patients ayant perdu leurs greffons. de la dysfonction chronique de l’allogreffe Nous avons également trouvé l’expression de la protéine CMV dans% des biopsies précoces examinées à partir de greffes fonctionnelles à long terme. Toutes ces biopsies ont été obtenues pour indication clinique; des signes histopathologiques de rejet étaient présents en% des biopsies précoces de la cohorte bien fonctionnée à long terme et en% des biopsies précoces de la cohorte de dysfonctionnement chronique de l’allogreffe. Cela confirme l’hypothèse selon laquelle une expression persistante de faible qualité des protéines CMV dans la En outre, les taux d’AIE du CMV étaient significativement plus bas dans les biopsies précoces de la population d’allogreffe fonctionnant correctement par rapport aux biopsies précoces de la cohorte de dysfonctionnement chronique de l’allogreffe. Bien que nous ayons trouvé des différences significatives Il est difficile de déterminer si cela est valable, car le statut sérologique du donneur n’était pas connu chez les patients présentant un dysfonctionnement chronique de l’allogreffe. Il n’y avait pas de différence significative entre les populations de patients en régime immunosuppresseur. donné ni dans le Nombre d’épisodes de rejet, facteurs connus pour influencer les taux de dysfonctionnement chronique de l’allogreffe Il n’y avait pas de différence significative dans le nombre de patients recevant un traitement d’induction, bien que l’incidence de l’infection à CMV soit similaire à celle du basiliximab et des globulines antithymocytaires. , cette différence n’a probablement pas affecté les résultats observés dans notre étude. Les patients qui étaient négatifs pour le CMV au début de la biopsie avaient une période de survie allogreffe significativement plus longue. Nous n’avons trouvé aucune différence significative des taux sériques de créatinine, obtenus au début des biopsies, entre les patients avec et sans l’expression de la protéine CMV, ce qui implique que le niveau intragrave du CMV peut être un meilleur prédicteur du résultat de la greffe que le taux de créatinine sériqueNotre étude est limitée par la population relativement petite et hétérogène des patientes excluant l’analyse covariable de la valeur prédictive CMV En outre, très peu de patie Comme il s’agissait d’une étude rétrospective, la cohorte des patients n’a pas été surveillée régulièrement pour la virémie CMV ou l’excrétion virale dans l’urine. Nous ne pouvons donc pas conclure si les patients ont été infectés par le CMV. Les biopsies de néphrectomies ayant été utilisées dans notre étude, l’immunosuppression avait été réduite ou interrompue chez plusieurs patients avant l’intervention, ce qui aurait pu affecter les changements morphologiques et l’expression de la protéine CMV. En résumé, nous montrons que les protéines CMV sont présentes dans la plupart des allogreffes rénales de dysfonctionnement chronique en phase terminale et que les niveaux intracrâniens de CMV ont une valeur pronostique pour le rejet des allogreffes. soutenir le rôle du CMV dans la pathogenèse du dysfonctionnement de l’allogreffe rénale chronique nction D’autres études prospectives sont nécessaires pour établir les mécanismes par lesquels le CMV favorise le rejet du greffon et évaluer l’efficacité de la prophylaxie ou du traitement antiviral dans la réduction du dysfonctionnement de l’allogreffe rénale chronique.

Remarques

Remerciements

Nous remercions Åsa Lidman et Ingrid Skarp de l’hôpital universitaire d’Uppsala pour leur aide dans la collecte de données sur les patients. Nous remercions Stephen Ordway d’avoir édité le manuscrit asthme.

Aide financière

Ce travail a été soutenu par le Conseil suédois de la recherche médicale [Dnr -]; la Fondation Suédoise du Coeur et des Poumons ; la Fondation Goljes [LA-, ​​LA-]; et le programme MD / OD-PhD de l’Institut Karolinska [à M D]

Conflits d’intérêts potentiels

Roche reçoit une subvention de recherche de Roche pour étudier les effets du traitement antiviral dans le glioblastome multiforme. C SN a reçu des honoraires de Roche pour des conférences de sciences fondamentales sur la pathologie du CMV MD a reçu un financement de voyage de la Société suédoise de médecine. a obtenu des subventions avec BristolMyersSquibb, Roche, AstraZeneca et Novartis Tous les autres auteurs ne signalent aucun conflit potentiel Tous les auteurs ont soumis le formulaire ICMJE pour la divulgation des conflits d’intérêts potentiels Conflits que les éditeurs jugent pertinents pour le contenu du manuscrit ont été divulgués |

Un traitement d’induction par des inhibiteurs de la protéase modifie l’effet de la résistance à la névirapine sur la réponse virologique à la multithérapie à base de névirapine chez les enfants

Tu peux Aussi comme